Skip to main content

Table 1 Polymorphisms typed in the EDN, ECP, EPO and MBP genes.

From: Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

Gene Rs number Location Amino acid Primer Annealing temperature Restriction enzyme
EDN rs2013109 Intron 1 - F: GGGTAAGTCAACGATCCCCAG
R: GGTCTTGGTTATGACACACACTGTAGT
69°C HpyF10VI
EDN rs10132319 Intron 1 - F: GGGTAAGTCAACGATCCCCAG
R: GGTCTTGGTTATGACACACACTGTAGT
65°C AciI
ECP rs17792481 Intron 1 - F: TGAGGGAGAGGTGAGCTGAAGT
R: TGATGTGCTGGATGGCAAAC
58°C MboI
ECP rs2073342 Exon 2 T124R F: TACGCTGCCCTCATAACAGAACT
R: GAACTGGAACCACAGGATACCG
58°C PstI
ECP rs2233860 3' UTR - F: GTATGCAGACAGACCAGGAAGGA
R: TTGGCAGATGAGTGATGATGAGTA
61°C RsaI
EPO rs11652709 Exon 4 Q122H F: CTACCCTGGCCTGGAGTAGAAG
R: CACGCACTTGTTGTTGCACC
64°C HpyF10VI
EPO rs3785496 Intron 6 - F: ACTGGTTGTCACTTCCCCTCTC
R: CAAAACCTTGCTTAAAACTCCCTT
58°C MseI
MBP rs490358 Exon 2 - F: GGAAAAAACAGAGAAAGAAAGACTGAA
R: CACTCCCACGGTCCCCTAAT
58°C BslI
MBP rs3741098 Intron 3 - F: TGGTGGACAAAAACCTTACGTGTC
R: ATGCTGGGGGCATATCCG A
58°C BsaHI