Skip to main content

Table 2 Summary of the screened SNPs, assays ID and probe sequences utilized in the study

From: Case-control association between CCT-associated variants and keratoconus in a Saudi Arabian population

dbSNP Gene symbol NCBI assembly locationa Assay ID Context sequence [VIC/FAM]
rs7606754 COL4A3 chr2: 228135180 C__381076_10 AAATATACTTAGATCAAACTATTCA[A/G]AGAGGCTTGTTAAAATTTACCAATA
rs4894535 FNDC3B chr3: 171995605 C__11808243_30 TTTTTTCCATTTTCCATAGTCCTTA[C/T]CCTTCCCTTTTGTTTTATATACCCA
rs1324183 MPDZ-NF1B chr9: 13557491 C___7609107_10 GGTTTGTTTTTCACCCTATTCCTCC[A/C]ACTTCCTTCAAGGCCCCTTAGAACT
rs1536482 RXRA-COL5A1 chr9: 137440528 C___9201021_10 TAGGCTCCAACATGTAAATGCTGGG[A/G]GGACGCACACGTTCAAACCATAGCA
rs7044529 COL5A1 chr9: 137568051 C__29292365_20 TTTCCAGAAGTAACCCCTCAACTCT[C/T]TGATCGGTATTGTTCTGGACTTACT
rs11145951 LCN12-PTGDS chr9: 139860264 C__31552589_20 AAGCTGCCAGTAGCTGCAGCTGGCC[C/T]GATGTGAGCCACAAAACCGGATGTG
rs2721051 FOXO1 chr13: 41110884 C__11302573_10 GAGCCAAATATCCTGCCAGCCAGCA[C/T]GGACCTGCTCCCAAGAATCATGTGT
rs9938149 BANP-ZNF49 chr16: 88331640 C__29917063_20 CTGCAATTGTCCCACAGGTCTTGTC[A/C]CCAGAAATCAAGTCCTTCTTCATCT
  1. SNP single nucleotide polymorphism; COL4A3 Collagen, type IV, alpha (Goodpasture antigen); FNDC3B fibronectin type III domain containing 3B; MPDZ multiple PDZ domain protein; NF1B neurofibromin 1b; COL5A1 collagen, type V, alpha 1; LCN12 lipocalin 12; PTGDS prostaglandin D2 synthase 21 kDa; FOXO1 forkhead box O1; BANP BTG3 associated nuclear protein; ZNF469 zinc finger protein 469
  2. aThe chromosomal location is based on UCSC GRCh37/hg19; chr, chromosome; Assays are supplied by Life technologies (Carlsbad, CA, USA)