Skip to main content

Table 4 Primers for FKBP12 and FKBP12.6 amplification of coding exons and flanking region sequences.

From: A negative screen for mutations in calstabin 1 and 2 genes in patients with dilated cardiomyopathy

Gene Exon Primer Amplicon
FKBP12 1F 5'- TCTCGGGGCTTCTGGGCTTC -3' 269
  1R 5'- GCGCCACTACTCACCGTCTC -3'  
  2F 5'- CATGCCCGTCTCTGTCTCCTCA -3' 242
  2R 5'- AAGCCCCAGGCTGCCCCTGA -3'  
  3F 5'- TGCTGCTGGTTTCTGACTTGT -3' 299
  3R 5'- TGGCATGAGGGTGAGACTTTTC -3'  
  4F 5'- TTTCTTACAGAGACAGTTGGGG -3' 253
  4R 5'- GCCCTTCAGTATTCCATTTCCT -3'  
FKBP12.6 1F 5'- GAATGGATGGATGGAGGATG -3' 527
  1R 5'- TCCTAGACCCCCAAGAATCC -3'  
  2F 5'-CCAGAGAGGTGACGTGA-3' 390
  2R 5'-TAGACTGGCTGGGAGGA-3'  
  3F 5'-GGGAGTTTACTCATGACCA-3' 368
  3R 5'-CAGGGACACAAAAGAGGTA-3'  
  4F 5'-CAGTCACATCTCTGCTGA-3' 510
  4R 5'-CGCATGAACACTGACGAA-3'